ID: 1115502224_1115502232

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1115502224 1115502232
Species Human (GRCh38) Human (GRCh38)
Location 14:34060168-34060190 14:34060208-34060230
Sequence CCGCGGCGGACACCGAGCCACAC GCGGCCGCCCCGAAGGTAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60} {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!