ID: 1115502228_1115502245

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1115502228 1115502245
Species Human (GRCh38) Human (GRCh38)
Location 14:34060199-34060221 14:34060237-34060259
Sequence CCTGCGCCCGCGGCCGCCCCGAA CGGCGGGCGGCGGCCGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 303} {0: 1, 1: 4, 2: 49, 3: 265, 4: 1565}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!