ID: 1115508881_1115508892

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1115508881 1115508892
Species Human (GRCh38) Human (GRCh38)
Location 14:34120343-34120365 14:34120385-34120407
Sequence CCAGCCCCCTTGCCCTAACTCAG CCCAGCTTCAGAGCTCCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 343} {0: 1, 1: 3, 2: 24, 3: 96, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!