ID: 1115530153_1115530156

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1115530153 1115530156
Species Human (GRCh38) Human (GRCh38)
Location 14:34319612-34319634 14:34319635-34319657
Sequence CCTTGCTTGAAAATATGCCAAGG CAGATCTATCTCCTTTAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 190} {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!