ID: 1115619044_1115619055

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1115619044 1115619055
Species Human (GRCh38) Human (GRCh38)
Location 14:35122724-35122746 14:35122766-35122788
Sequence CCCCCCACCGGAGGAGTTTTGCG GGGTGAGGGCCCCTAGACTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47} {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!