ID: 1115712572_1115712583

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1115712572 1115712583
Species Human (GRCh38) Human (GRCh38)
Location 14:36067182-36067204 14:36067233-36067255
Sequence CCAACTTGCTTTTGCCCCCACAG TCTGAGGCTAGGTCATAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 193} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!