ID: 1115796745_1115796750

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1115796745 1115796750
Species Human (GRCh38) Human (GRCh38)
Location 14:36945371-36945393 14:36945421-36945443
Sequence CCAAAGAACTGAAAGCAGAGACT ACAGCAGCGCTATTCATGAGAGG
Strand - +
Off-target summary {0: 5, 1: 22, 2: 99, 3: 239, 4: 719} {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!