ID: 1115832824_1115832827

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1115832824 1115832827
Species Human (GRCh38) Human (GRCh38)
Location 14:37361586-37361608 14:37361636-37361658
Sequence CCTTTTTTGTTTCTCCCTCTCTC TTGCCTCTCTCGCAGTCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 78, 3: 694, 4: 4005} {0: 1, 1: 0, 2: 0, 3: 15, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!