ID: 1115882889_1115882893

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1115882889 1115882893
Species Human (GRCh38) Human (GRCh38)
Location 14:37939876-37939898 14:37939926-37939948
Sequence CCTGGCTCTGCCACTCACTGGCT CCTACAATGTAAAATGAGAATGG
Strand - +
Off-target summary {0: 3, 1: 43, 2: 229, 3: 986, 4: 3103} {0: 1, 1: 0, 2: 1, 3: 22, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!