ID: 1115951578_1115951587

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1115951578 1115951587
Species Human (GRCh38) Human (GRCh38)
Location 14:38727776-38727798 14:38727817-38727839
Sequence CCATGGACAACAGCTGTTCCCCG TGAGGTCAAGGCTTAGTACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 14, 4: 123} {0: 1, 1: 1, 2: 8, 3: 22, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!