ID: 1115954440_1115954446

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1115954440 1115954446
Species Human (GRCh38) Human (GRCh38)
Location 14:38762437-38762459 14:38762484-38762506
Sequence CCATGCACCATCTGCAAGAAAGG TCCAAATCCAAACGATTATACGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!