ID: 1116017706_1116017708

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1116017706 1116017708
Species Human (GRCh38) Human (GRCh38)
Location 14:39427222-39427244 14:39427253-39427275
Sequence CCAATACAGCTGTGGAATAAAAA ACCTCTCATAACAGCCTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 301} {0: 1, 1: 0, 2: 0, 3: 13, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!