ID: 1116018304_1116018306

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1116018304 1116018306
Species Human (GRCh38) Human (GRCh38)
Location 14:39432338-39432360 14:39432353-39432375
Sequence CCTCGCTCGTAAACTTCAGCGGC TCAGCGGCCCGGAAGCCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 13} {0: 1, 1: 0, 2: 0, 3: 11, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!