ID: 1116158377_1116158382

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1116158377 1116158382
Species Human (GRCh38) Human (GRCh38)
Location 14:41236654-41236676 14:41236692-41236714
Sequence CCAGTAACAGGCCAAGAGCTGTC AGCTATCTGCAGAAGGTGACAGG
Strand - +
Off-target summary {0: 162, 1: 189, 2: 129, 3: 114, 4: 178} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!