ID: 1116317075_1116317084

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1116317075 1116317084
Species Human (GRCh38) Human (GRCh38)
Location 14:43410731-43410753 14:43410760-43410782
Sequence CCCTGAGAGTACAGGGATGCCCA TAGCTGCAGCCAGGAGGGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 16, 3: 82, 4: 544}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!