ID: 1116318892_1116318893

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1116318892 1116318893
Species Human (GRCh38) Human (GRCh38)
Location 14:43434259-43434281 14:43434274-43434296
Sequence CCTGTTCTTAAAAGGCTTGAGAC CTTGAGACCTGACATTGACTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!