ID: 1116443038_1116443041

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1116443038 1116443041
Species Human (GRCh38) Human (GRCh38)
Location 14:44976475-44976497 14:44976528-44976550
Sequence CCCACTATACTCTGAGCACATTG AGTATCTTTAGCACAGTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 303} {0: 1, 1: 1, 2: 3, 3: 40, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!