ID: 1116519241_1116519246

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1116519241 1116519246
Species Human (GRCh38) Human (GRCh38)
Location 14:45830358-45830380 14:45830398-45830420
Sequence CCTGTGATATTGTTCCTTATATC TATTACTCCCAATATTGCACTGG
Strand - +
Off-target summary No data {0: 2, 1: 101, 2: 550, 3: 1126, 4: 1668}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!