|
Left Crispr |
Right Crispr |
Crispr ID |
1116519241 |
1116519246 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:45830358-45830380
|
14:45830398-45830420
|
Sequence |
CCTGTGATATTGTTCCTTATATC |
TATTACTCCCAATATTGCACTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 2, 1: 101, 2: 550, 3: 1126, 4: 1668} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|