ID: 1116583581_1116583586

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1116583581 1116583586
Species Human (GRCh38) Human (GRCh38)
Location 14:46674250-46674272 14:46674299-46674321
Sequence CCCCTGGCAGCAGACACATGGCA GAGGGAAGCACAGTGATTGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!