ID: 1116614759_1116614761

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1116614759 1116614761
Species Human (GRCh38) Human (GRCh38)
Location 14:47120514-47120536 14:47120565-47120587
Sequence CCTATTTTCTTCAGGAACAGAAG GAAAAAAATAAATATAAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 292} {0: 1, 1: 2, 2: 21, 3: 368, 4: 5325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!