ID: 1116838780_1116838785

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1116838780 1116838785
Species Human (GRCh38) Human (GRCh38)
Location 14:49797908-49797930 14:49797953-49797975
Sequence CCCATGTCTTTGTGGGTTTTCAC CATCCCAAAATGCGCATGTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 45, 3: 108, 4: 380} {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!