ID: 1116862451_1116862455

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1116862451 1116862455
Species Human (GRCh38) Human (GRCh38)
Location 14:50005507-50005529 14:50005525-50005547
Sequence CCCCGAAGCAGCAGACACTTAAA TTAAATAAGCAGCAGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 141} {0: 1, 1: 0, 2: 3, 3: 34, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!