ID: 1116919714_1116919723

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1116919714 1116919723
Species Human (GRCh38) Human (GRCh38)
Location 14:50560346-50560368 14:50560365-50560387
Sequence CCCTCCACTTTCTGCTTCTGTGG GTGGAGACAGGGAGGGCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 88, 4: 570} {0: 1, 1: 0, 2: 4, 3: 65, 4: 504}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!