ID: 1117001597_1117001600

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1117001597 1117001600
Species Human (GRCh38) Human (GRCh38)
Location 14:51376285-51376307 14:51376315-51376337
Sequence CCTGTGATCTTCTGCAGATAACT TTTTGAGAGACAGCTCTTGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!