ID: 1117151165_1117151171

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1117151165 1117151171
Species Human (GRCh38) Human (GRCh38)
Location 14:52889851-52889873 14:52889880-52889902
Sequence CCAGGTGTTGGCTCATGCTTGTA ACACTTTGGGAGGCCAAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 47, 3: 204, 4: 625} {0: 2536, 1: 40105, 2: 146028, 3: 241222, 4: 211356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!