ID: 1117369398_1117369410

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1117369398 1117369410
Species Human (GRCh38) Human (GRCh38)
Location 14:55062887-55062909 14:55062919-55062941
Sequence CCCACCTGGTGGTCCTTATCCAG TGCCGGGCCCTGGCCCCACAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 15, 4: 228} {0: 1, 1: 0, 2: 3, 3: 26, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!