ID: 1117378183_1117378189

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1117378183 1117378189
Species Human (GRCh38) Human (GRCh38)
Location 14:55134851-55134873 14:55134893-55134915
Sequence CCATGTTCAAAAAGAGATGTGTG GCCTGTAATCCCAGCACTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 227} {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!