ID: 1117400113_1117400120

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1117400113 1117400120
Species Human (GRCh38) Human (GRCh38)
Location 14:55351414-55351436 14:55351466-55351488
Sequence CCTGTGGGGTCTGTATCTGTGGA CTCCTAAGGAGGACCAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 377} {0: 1, 1: 0, 2: 1, 3: 20, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!