ID: 1117490286_1117490292

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1117490286 1117490292
Species Human (GRCh38) Human (GRCh38)
Location 14:56240327-56240349 14:56240358-56240380
Sequence CCAGAGATGCGTAGGAGGTAGAA CTGGGTAAATGATTGGATGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 84} {0: 1, 1: 0, 2: 3, 3: 36, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!