ID: 1117605851_1117605853

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1117605851 1117605853
Species Human (GRCh38) Human (GRCh38)
Location 14:57428342-57428364 14:57428376-57428398
Sequence CCTTGTTCAATGTGTATTACCTG ATTTATTAGCCTCTTTGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 155} {0: 1, 1: 0, 2: 2, 3: 19, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!