ID: 1117629700_1117629703

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1117629700 1117629703
Species Human (GRCh38) Human (GRCh38)
Location 14:57677698-57677720 14:57677711-57677733
Sequence CCCCTTCACACATACATATATGC ACATATATGCATAAAATGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 94, 4: 838} {0: 1, 1: 1, 2: 5, 3: 98, 4: 1331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!