ID: 1117645545_1117645549

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1117645545 1117645549
Species Human (GRCh38) Human (GRCh38)
Location 14:57848239-57848261 14:57848264-57848286
Sequence CCACCCTCATTCAGCATTTGACT ACCTCCCTTCACCCTGGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 191} {0: 1, 1: 0, 2: 1, 3: 24, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!