ID: 1117648028_1117648036

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1117648028 1117648036
Species Human (GRCh38) Human (GRCh38)
Location 14:57872948-57872970 14:57872980-57873002
Sequence CCCTGCTCCACCAATCACAGCAT ATTTTGAATGGGAAGCCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 205} {0: 1, 1: 0, 2: 0, 3: 18, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!