|
Left Crispr |
Right Crispr |
| Crispr ID |
1117716813 |
1117716819 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:58589560-58589582
|
14:58589598-58589620
|
| Sequence |
CCCAGTAGTCATTCAGGAGCAGG |
GTAGTTGAGCGGTTTTGAGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6882, 1: 3380, 2: 1919, 3: 1766, 4: 2040} |
{0: 13, 1: 53, 2: 62, 3: 56, 4: 96} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|