|
Left Crispr |
Right Crispr |
Crispr ID |
1117716815 |
1117716819 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:58589561-58589583
|
14:58589598-58589620
|
Sequence |
CCAGTAGTCATTCAGGAGCAGGT |
GTAGTTGAGCGGTTTTGAGTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 7186, 1: 3446, 2: 1974, 3: 1828, 4: 2105} |
{0: 13, 1: 53, 2: 62, 3: 56, 4: 96} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|