ID: 1117835221_1117835223

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1117835221 1117835223
Species Human (GRCh38) Human (GRCh38)
Location 14:59797782-59797804 14:59797815-59797837
Sequence CCTAGCGTCATCTTTGTTAACAC TAGTGTTTATAGTGTTTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 114} {0: 1, 1: 1, 2: 0, 3: 16, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!