ID: 1117920298_1117920308

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1117920298 1117920308
Species Human (GRCh38) Human (GRCh38)
Location 14:60721742-60721764 14:60721760-60721782
Sequence CCCCTTGCCACCCTCTGCCCCGG CCCGGCCCTGCGGATTCCGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 607} {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!