ID: 1117941524_1117941527

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1117941524 1117941527
Species Human (GRCh38) Human (GRCh38)
Location 14:60971958-60971980 14:60971980-60972002
Sequence CCAAGGTGGCCATGTGTGTCAAA AGTCAGGAAATCCCTCCTCCTGG
Strand - +
Off-target summary {0: 20, 1: 14, 2: 7, 3: 12, 4: 160} {0: 2, 1: 19, 2: 22, 3: 29, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!