|
Left Crispr |
Right Crispr |
Crispr ID |
1117941524 |
1117941528 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:60971958-60971980
|
14:60971981-60972003
|
Sequence |
CCAAGGTGGCCATGTGTGTCAAA |
GTCAGGAAATCCCTCCTCCTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 20, 1: 14, 2: 7, 3: 12, 4: 160} |
{0: 2, 1: 18, 2: 22, 3: 43, 4: 928} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|