ID: 1117942873_1117942874

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1117942873 1117942874
Species Human (GRCh38) Human (GRCh38)
Location 14:60987703-60987725 14:60987739-60987761
Sequence CCATTCTTTTGGAATACTTCTCA AACCCACAGCTCCCCTCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 390} {0: 1, 1: 0, 2: 2, 3: 33, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!