ID: 1118001121_1118001130

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1118001121 1118001130
Species Human (GRCh38) Human (GRCh38)
Location 14:61524958-61524980 14:61524991-61525013
Sequence CCTTCCATCCCCTAAAAATAAGA GTTGGCCAGGGCAGTCCCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 311} {0: 1, 1: 0, 2: 1, 3: 9, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!