ID: 1118054417_1118054424

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1118054417 1118054424
Species Human (GRCh38) Human (GRCh38)
Location 14:62064588-62064610 14:62064611-62064633
Sequence CCAGAATTTAAGAAGTTTTTTCC ATGGGGAAACAGATGGTAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 355} {0: 1, 1: 0, 2: 4, 3: 39, 4: 438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!