ID: 1118054499_1118054500

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1118054499 1118054500
Species Human (GRCh38) Human (GRCh38)
Location 14:62065520-62065542 14:62065541-62065563
Sequence CCATATACTAATAAATTAGTTGC GCAATTATTAATTTTATAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 143} {0: 1, 1: 0, 2: 4, 3: 57, 4: 555}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!