ID: 1118125108_1118125117

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1118125108 1118125117
Species Human (GRCh38) Human (GRCh38)
Location 14:62893218-62893240 14:62893260-62893282
Sequence CCCTCATGGATGACTTTGAGGGG GAGTAACTGCAGATGTGGTGGGG
Strand - +
Off-target summary {0: 127, 1: 350, 2: 455, 3: 457, 4: 396} {0: 1, 1: 0, 2: 2, 3: 23, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!