ID: 1118163989_1118163993

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1118163989 1118163993
Species Human (GRCh38) Human (GRCh38)
Location 14:63317912-63317934 14:63317940-63317962
Sequence CCAACCATGCATTTGTCACTATC GACCTTGCTCCTAGCATTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 150} {0: 1, 1: 0, 2: 0, 3: 13, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!