ID: 1118236549_1118236556

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1118236549 1118236556
Species Human (GRCh38) Human (GRCh38)
Location 14:64010394-64010416 14:64010439-64010461
Sequence CCTTTGCACTGACTTTCTGTTTA CAGGCTTGACAGAAGGAAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 330} {0: 1, 1: 0, 2: 3, 3: 37, 4: 426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!