ID: 1118241074_1118241082

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1118241074 1118241082
Species Human (GRCh38) Human (GRCh38)
Location 14:64059700-64059722 14:64059742-64059764
Sequence CCCTTGGGCTCTACAATCAACAG TTGTGTCCTTCCCTTAAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 132, 3: 325, 4: 495} {0: 2, 1: 32, 2: 125, 3: 208, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!