ID: 1118253949_1118253955

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1118253949 1118253955
Species Human (GRCh38) Human (GRCh38)
Location 14:64188807-64188829 14:64188859-64188881
Sequence CCAGTAGCATTTTAGAAATTTGA GAGAACAGTTGGAAGAGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 320} {0: 1, 1: 0, 2: 1, 3: 45, 4: 559}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!