ID: 1118260214_1118260224

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1118260214 1118260224
Species Human (GRCh38) Human (GRCh38)
Location 14:64239315-64239337 14:64239343-64239365
Sequence CCACCCACCCACTCCATGGGAAC CTATAAACTCAGAGGGAACTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 213, 3: 226, 4: 583} {0: 1, 1: 0, 2: 0, 3: 16, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!