ID: 1118293735_1118293743

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1118293735 1118293743
Species Human (GRCh38) Human (GRCh38)
Location 14:64549876-64549898 14:64549910-64549932
Sequence CCGCAGCCCGCGCGGCCTAGGAC CCCGCCCCGCTCCGCGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 125} {0: 2, 1: 3, 2: 25, 3: 152, 4: 851}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!